primer 8.0 statistical software Search Results


gene exp adgre1 mm00802529 m1  (Thermo Fisher)
99
Thermo Fisher gene exp adgre1 mm00802529 m1
Gene Exp Adgre1 Mm00802529 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/Gene+Exp%2E+adgre1+mm00802529+m1/pm35787975-233-14--1
Average 99 stars, based on 1 article reviews
gene exp adgre1 mm00802529 m1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
random primers  (GenHunter Corporation)
90
GenHunter Corporation random primers
Random Primers, supplied by GenHunter Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/arbitrary+primers/pm15708560-43-13-9
Average 90 stars, based on 1 article reviews
random primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
oligo-dt(15) primer  (Promega)
90
Promega oligo-dt(15) primer
Oligo Dt(15) Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/oligo+dt++primers/pm12558972-61-63-65
Average 90 stars, based on 1 article reviews
oligo-dt(15) primer - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
deep vent polymerase  (New England Biolabs)
95
New England Biolabs deep vent polymerase
Deep Vent Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/Deep+Vent+(exo-)+DNA+Polymerase/us08058029-201-41-52
Average 95 stars, based on 1 article reviews
deep vent polymerase - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier
multidetector scanner with 80 detector rows aquilion prime  (Canon inc)
90
Canon inc multidetector scanner with 80 detector rows aquilion prime
Multidetector Scanner With 80 Detector Rows Aquilion Prime, supplied by Canon inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/aquilion+one/pmc08120249-87-11-15
Average 90 stars, based on 1 article reviews
multidetector scanner with 80 detector rows aquilion prime - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
80-row multi-slice ct scanner aquilion prime  (TOSHIBA Medical)
90
TOSHIBA Medical 80-row multi-slice ct scanner aquilion prime
80 Row Multi Slice Ct Scanner Aquilion Prime, supplied by TOSHIBA Medical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/aquilion+64/pmc09265120-45-6-12
Average 90 stars, based on 1 article reviews
80-row multi-slice ct scanner aquilion prime - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
vwr extra pure  (Chem Impex International)
95
Chem Impex International vwr extra pure
Vwr Extra Pure, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/Isopropyl+alcohol/pm20670021__ol101450u_si_001-34-28-32
Average 95 stars, based on 1 article reviews
vwr extra pure - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier
e prime 3 0  (Psychology Software Tools)
99
Psychology Software Tools e prime 3 0
E Prime 3 0, supplied by Psychology Software Tools, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/E-Prime/10__1080_slash_1359432x__2026__2624587-449-10-13
Average 99 stars, based on 1 article reviews
e prime 3 0 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
trigrid delivery system  (Ichor Medical)
90
Ichor Medical trigrid delivery system
Trigrid Delivery System, supplied by Ichor Medical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/trigrid+delivery+system/us09371366-2162-7-16
Average 90 stars, based on 1 article reviews
trigrid delivery system - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
gene exp sev mr04269880 mr  (Thermo Fisher)
89
Thermo Fisher gene exp sev mr04269880 mr
Characterization and validation
Gene Exp Sev Mr04269880 Mr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/Gene+Exp%2E+SEV%2C+Mr04269880_mr/pmc10576909-115-165-148
Average 89 stars, based on 1 article reviews
gene exp sev mr04269880 mr - by Bioz Stars, 2026-09
89/100 stars
  Buy from Supplier
eva green amplification cocktail  (Biotium)
97
Biotium eva green amplification cocktail
Characterization and validation
Eva Green Amplification Cocktail, supplied by Biotium, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/EvaGreen/pmc04746681-610-14-44
Average 97 stars, based on 1 article reviews
eva green amplification cocktail - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier
5 prime® taq dna polymerase  (5 PRIME)
90
5 PRIME 5 prime® taq dna polymerase
Characterization and validation
5 Prime® Taq Dna Polymerase, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+8%2E0+statistical+software/5+prime+taq+dna+polymerase/pmc05550527-121-82-81
Average 90 stars, based on 1 article reviews
5 prime® taq dna polymerase - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Characterization and validation

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet: Characterization and validation

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Expressing, Flow Cytometry, Mutagenesis, Sequencing, Southern Blot, Virus, Reverse Transcription Polymerase Chain Reaction

Reagents details

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet: Reagents details

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Flow Cytometry, Immunohistochemistry, Mutagenesis, Sequencing, Control

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet:

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Virus, Modification, Mutagenesis